View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_510 (Length: 221)
Name: NF6864A_low_510
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_510 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 3790340 - 3790141
Alignment:
| Q |
20 |
aggaataggagcaaatagtcatatttctcaacaagnnnnnnnntaaactcatcatctcaattaaaacttatctcgcttatgattattctaatttgttttc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790340 |
aggaataggagcaaatagtcatatttctcaacaaggaaaaaa-taaactcatcatctcaattagaacttatctcgcttatgattattctaatttgttttc |
3790242 |
T |
 |
| Q |
120 |
aattaatttgttgagtatgactactcatagacacatacgaggggaagggcgaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790241 |
aattaatttgttgagtatgactactcatagacacataagaggggaaggaagaggaaggtgatcatctagcatggcattgcgaagctcccttcaactttag |
3790142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University