View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_511 (Length: 221)
Name: NF6864A_low_511
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_511 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 29674938 - 29675143
Alignment:
| Q |
14 |
gacatcaacggaaggacaaggcacatgtattaatgttgaagagaatgtagtgaaaaagatgcttatgttgaaaatgactcctaccattctcaggagctaa |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29674938 |
gacatcaacggaaggacaaggggcatgtattaatgttgaagagaatgtagttaaaatgatgcttatgttgaaaatgactcctaccattctcaggagctaa |
29675037 |
T |
|
| Q |
114 |
taagccctcttcagtattgatgatgaatatgatggaaatacaagacaaatttttctttattttgaatcaaatgcgaagtttggtaggaatgaaatttgaa |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
29675038 |
taagcccttttcagtattgatgatgaatatgatggaaatacgagacaaatttttcttcattttgaatcaaatgtgaagtttgctaggaataaaatttgaa |
29675137 |
T |
|
| Q |
214 |
actttg |
219 |
Q |
| |
|
|||||| |
|
|
| T |
29675138 |
actttg |
29675143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University