View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_516 (Length: 220)
Name: NF6864A_low_516
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_516 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 38 - 186
Target Start/End: Complemental strand, 31922965 - 31922818
Alignment:
| Q |
38 |
atcacatggacatggcgtagaactctcagcttagttgaaagaagcacgttcagttcttctattgtgnnnnnnnnaaggaaatgcttaatccttacttgaa |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||| ||||||||| |
|
|
| T |
31922965 |
atcacatggacatggcgtagaactctcagcttagttgaaagaagcacgttcagttcttctattttgtttttttta-ggaaatgcttaatctttacttgaa |
31922867 |
T |
|
| Q |
138 |
ggacgtgcataggactagattttgttgaaaataatgtattatcatgtgt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31922866 |
ggacgtgcataggactagattttgttgaaaataatgtattttcatgtgt |
31922818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University