View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_555 (Length: 204)
Name: NF6864A_low_555
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_555 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 182
Target Start/End: Complemental strand, 47436875 - 47436716
Alignment:
| Q |
23 |
acaattgagttgtgagctaggtcttacaccgacgcaaatcaagttctggtttcaaaacaagcgcaaccaaattaaggtaaaggattatgaaaaccctatt |
122 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436875 |
acaattgagttgtgagctaggccttacacctgcgcaaatcaagttctagtttcaaaacaagcgcaaccaaattaaggtaaaggattatgaaaaccctatt |
47436776 |
T |
 |
| Q |
123 |
gaaatgtgagatcttacatgcatggtgaacccttaaaaataaatgtgtatttcctctggt |
182 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47436775 |
gaaatttgagatcttacatgcacggtgaacccttaaaaataaatgtgtatttcctctggt |
47436716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University