View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_80 (Length: 360)
Name: NF6864A_low_80
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 23 - 349
Target Start/End: Complemental strand, 37346139 - 37345813
Alignment:
| Q |
23 |
aacactatacctcatccatagtaattaaccaacatggacataggaaccaagcaaagtccccttttcttcaaatctgcacactcaatattttttccattga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37346139 |
aacactatacctcatccatagtaattaaccaacatggacataggaaccaagcaaagtccccttttcttcaaatctgcgcactcaatattttttccattga |
37346040 |
T |
 |
| Q |
123 |
aattcatatcacaatcatttgtctctagcttttgataatgctctgatttaaatcccctatcctacaaaatcatcatcataaacaatagtatttagttaag |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37346039 |
aattcatatcacaatcatttgtctctagcttttgataatgctctgatttaaatcccctatcctacaaaatcatcatcataaacaatagtatttagttaag |
37345940 |
T |
 |
| Q |
223 |
atgaaaattccaaaatcatttcttaaagaaaaatgaaaacatcaattaagaatgaatcatagttgattaccctagagccatctagttgatcatccatctt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37345939 |
atgaaaattccaaaatcatttcttaaagaaaaataaaaacatcaattaagaatgaatcatagttgattaccctagagccatctagttgatcatccatctt |
37345840 |
T |
 |
| Q |
323 |
ccttgaaatcattgttgttggattcat |
349 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
37345839 |
ccttgaaatcattgttgttggattcat |
37345813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University