View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6864A_low_81 (Length: 360)
Name: NF6864A_low_81
Description: NF6864A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6864A_low_81 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 7 - 347
Target Start/End: Original strand, 250001 - 250342
Alignment:
| Q |
7 |
catttgaggccacagagactatagctgttagagtaacagttacaattatcaatcaattaccggcaccatttttcatattacgttgccaatctagagataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250001 |
catttgaggccacagagactatagctgttagagtaacagttacaattatcaatcaattaccggcaccatttttcatattacgttgccaatctagagataa |
250100 |
T |
|
| Q |
107 |
cgatcttaaagttcacaatgtccaatacggaggaagttacacattttcatttaaaccatcagtgattatttttaaaactacgttattcttctgcagcttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250101 |
cgatcttaaagttcacaatgtccaatacggaggaagttacacattttcatttaaaccatctgtgattatttttaaaactacgttattcttctgcagcttt |
250200 |
T |
|
| Q |
207 |
agatggcctagcgaccctcgccgtcattatcttaacgtatatgatgaagaccgagacggccgcaacaatagtgattgggaaataaatataggtggaggtt |
306 |
Q |
| |
|
| ||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
250201 |
acatggcctagtgaccatcgccgtcattatcttaacgtatatgatgaagaccgagacggccgcaacaattgtgattgggaaataaatataggtggaggtt |
250300 |
T |
|
| Q |
307 |
gtttgagcaagaag-aaaagaagagacgttttccttggagaa |
347 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
250301 |
gtttgagcaagaagaaaaagaagagatgttttccttggagaa |
250342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University