View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_133 (Length: 269)
Name: NF6865A_low_133
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_133 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 10 - 259
Target Start/End: Original strand, 5726346 - 5726608
Alignment:
| Q |
10 |
actaattatttagtttggagttccaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaaaag |
109 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5726346 |
actaattatttagtttggagtttcaatttaaacctgtgcatatgaaaaatatatacccgaatatgtcaatatcataaaatgatatcaattaactcaaaag |
5726445 |
T |
|
| Q |
110 |
gaatctctacgag--------------acattatttgtttgctaaggaaaaactaagaagttaagggtgcaaaaattaactctaaattttatgcttcatt |
195 |
Q |
| |
|
|||||||| | | |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5726446 |
gaatctctgcaattgctcgtagatgttacattatttgtt-gctaaggaaaaactaagaagttaaggttgcaaaaattaactctaaattttatgcttcatt |
5726544 |
T |
|
| Q |
196 |
atgtcggcatatgttaatatcttaattaaattaaagaaatgctttttccagtctactatattct |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
5726545 |
atgtcggcatatgttaatatcttaattaaattaaagaaatgcttttttcagtctactattttct |
5726608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University