View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_174 (Length: 249)
Name: NF6865A_low_174
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_174 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 1 - 136
Target Start/End: Original strand, 11685820 - 11685949
Alignment:
| Q |
1 |
attagattgatacatgtacatgaatggtcaacaacaagaacaacaataaccttagtaaagcttaattctagtgttaatgcagcttctgcagatggggcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11685820 |
attagattgatacatgtacatgaatggtcaacaaca------acaataaccttagtaaagcttaattctagtgttaatgcagcttctgcagatggggcat |
11685913 |
T |
|
| Q |
101 |
gacttaagctcttttccacattcacagcaagtcttc |
136 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11685914 |
gacttaagctcttttccacattcacaacaagtcttc |
11685949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 11685971 - 11686015
Alignment:
| Q |
157 |
tatcaaataacatacctcatatatttgatgtattttgaacaattt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11685971 |
tatcaaataacatacctcatatatttgatgtattttgagcaattt |
11686015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University