View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_182 (Length: 248)
Name: NF6865A_low_182
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_182 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 34824439 - 34824669
Alignment:
| Q |
1 |
tatatggctgagttggaacgggttttatttgccgtttataaatgtcgagccttgttactaaatcatcaaaattgtagtctgtatgactggatttatcaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34824439 |
tatatggctgagttggaacgggttttatttgccgtttataaatgtcgagccttgttactaaatcatcaaaattgtagtctgtatgactggatttatcaca |
34824538 |
T |
|
| Q |
101 |
agaaaaatgatgtaaaccttgttgctcatactctctaactatagcgtgaaggtcttatgttagcacaaagcacgcaagtattgtaaggcacgatgtattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| | || | |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34824539 |
agaaaaatgatgtaaaccttgttgctcatactctctaaccatagc----acatccaa---aagcacaaagcacgcaagtattggaaggcacgatgtattt |
34824631 |
T |
|
| Q |
201 |
attcatctatgataactaaacaagtgatgtccatctca |
238 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
34824632 |
attcatctatgataactaaacaagtaatgtccatctca |
34824669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University