View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_184 (Length: 248)
Name: NF6865A_low_184
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_184 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 136; Significance: 5e-71; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 16 - 231
Target Start/End: Complemental strand, 24301261 - 24301046
Alignment:
| Q |
16 |
atgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttcctcgttgagttgaaaaaagctcatcaatagctctaaacagatgctcatccg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| || | ||||||||| ||| |||| |||||| ||| |||| |
|
|
| T |
24301261 |
atgttggaagtgttggagtggactctgatcaatgttgaagaaaagtttctccgttaagcgtatgaaagctcataaatggctccaaacaggtgcgcatcat |
24301162 |
T |
|
| Q |
116 |
aacccacactgcgggcttcgaagcccaaatgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtagggttggaactaaaatat |
215 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
24301161 |
aacccacactgcgggcttcaaagcccaagtgaaaattggtacaagaatgagcataaagttaaagatattttactaggttgtatggttggaaataaaatat |
24301062 |
T |
|
| Q |
216 |
gatatgtctaaattga |
231 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
24301061 |
gatatgtctaagttga |
24301046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University