View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_189 (Length: 247)
Name: NF6865A_low_189
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_189 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 8 - 232
Target Start/End: Complemental strand, 17642815 - 17642591
Alignment:
| Q |
8 |
ggctggtaaatctatggaagaggtgacgaagggaagggtgtgctggatcggtgacagtgagtgaaaatatgagacggttggtgatggataaaaactgttt |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17642815 |
ggctggtgaatctatggaagaggtgacgaaggggagggtgtgctggatcgctgacagtgagtgaaaatatgagacggttggtgatagataaaaactgttt |
17642716 |
T |
|
| Q |
108 |
agaaacgagggaaagaggctcaaggttgcgttggttgttgccgtcatcgtcgacgacgatgaggattttgaagacagactcccaacactcatcaggcaaa |
207 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
17642715 |
agaaatgagggaaagaggctcaaggttgcgttggttgttgccgtcatcgtccacgacgttgaggaatttgaagacagactcccaacactcatcaggtaaa |
17642616 |
T |
|
| Q |
208 |
taaaaagaaatgggtttattccttt |
232 |
Q |
| |
|
||||| | ||||| ||| ||||||| |
|
|
| T |
17642615 |
taaaaggcaatggttttcttccttt |
17642591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 17635528 - 17635415
Alignment:
| Q |
16 |
aatctatggaagaggtgacgaagggaagggtgtgctggatcggtgacagtgagtgaaaatatgagacggttggtgatggata-aaaactgtttagaaacg |
114 |
Q |
| |
|
|||||||| ||||||||||||||| | | ||| |||| | | |||| ||||||| ||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
17635528 |
aatctatgaaagaggtgacgaaggtgatgatgttctggcttagagacattgagtgagaatatgagacggttggtaatggatagaaaactgtttagaaaca |
17635429 |
T |
|
| Q |
115 |
agggaaagaggctc |
128 |
Q |
| |
|
|| ||||||||||| |
|
|
| T |
17635428 |
agagaaagaggctc |
17635415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 125
Target Start/End: Complemental strand, 2621208 - 2621162
Alignment:
| Q |
79 |
agacggttggtgatggataaaaactgtttagaaacgagggaaagagg |
125 |
Q |
| |
|
||||||||||||||||| ||||||||||| || |||||||| ||||| |
|
|
| T |
2621208 |
agacggttggtgatggacaaaaactgtttggatacgagggagagagg |
2621162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 110
Target Start/End: Original strand, 553992 - 554037
Alignment:
| Q |
65 |
tgagtgaaaatatgagacggttggtgatggataaaaactgtttaga |
110 |
Q |
| |
|
||||||| ||| ||||||| |||||||||||||| ||||||||||| |
|
|
| T |
553992 |
tgagtgagaatctgagacgattggtgatggataagaactgtttaga |
554037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 79 - 124
Target Start/End: Original strand, 5035634 - 5035679
Alignment:
| Q |
79 |
agacggttggtgatggataaaaactgtttagaaacgagggaaagag |
124 |
Q |
| |
|
||||||||||||||||| | ||||||||| ||||||| |||||||| |
|
|
| T |
5035634 |
agacggttggtgatggagagaaactgttttgaaacgaaggaaagag |
5035679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University