View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_193 (Length: 246)
Name: NF6865A_low_193
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_193 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 32002652 - 32002445
Alignment:
| Q |
20 |
acatatttggaaaacagcccatgatgaaaatgctgatcaagcttgtgagattgtggattactgagtttgagtgtcttgacgaagaggtgttttgggctgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32002652 |
acatatttggaaaacagcccatgatgaaaatgctgatcaagcttgtgagattgtggattactgagtttgagtgtcttgacgaagaggtgttttgggctgg |
32002553 |
T |
|
| Q |
120 |
attttgggacttggttgggataaactttagctttcccattatgtatattttcccaattttgagctctcctctaagctttgccacgtctctgtagcctgtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32002552 |
attttgggacttggttgggataaactttagctttcccattatgtatattttcccaattttgagcactcctctaagctttgccacgtctctgtagcctgtg |
32002453 |
T |
|
| Q |
220 |
atatcact |
227 |
Q |
| |
|
|||||||| |
|
|
| T |
32002452 |
atatcact |
32002445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University