View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_198 (Length: 245)
Name: NF6865A_low_198
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_198 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 14 - 128
Target Start/End: Complemental strand, 56487616 - 56487502
Alignment:
| Q |
14 |
gaaaccaaatctgccaagagatttcacttacagaggcagttagtttgagcggcggagtgatttagggtttcagttcctctcactgctatgcgatttacta |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56487616 |
gaaaccaaatctgccaagagattttacttacagaggcagttagtttgagcggcggagtgatttagggtttcagttcctctcactgctatgcgatttacta |
56487517 |
T |
 |
| Q |
114 |
gtactagtatattcc |
128 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
56487516 |
gtactagtatattcc |
56487502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University