View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_207 (Length: 243)
Name: NF6865A_low_207
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_207 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 28 - 191
Target Start/End: Original strand, 9457146 - 9457309
Alignment:
| Q |
28 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccattttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457146 |
tgtttactttatagatgatcattagattgtaataaaaatcacatatagccgttttggaatacggtaataaaaatctcaacactcattttgttaccgatct |
9457245 |
T |
 |
| Q |
128 |
caagtttgtgttttgtgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
191 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9457246 |
caagtttgtgttttgcgtaggggagagataaaatgtttataaattacaattaatcttgattttc |
9457309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 187 - 228
Target Start/End: Original strand, 9458329 - 9458370
Alignment:
| Q |
187 |
ttttcgcaattcctctttcagttccttttggattttgtttat |
228 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9458329 |
ttttcacaattcctctttcaattccttttggattttgtttat |
9458370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University