View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_212 (Length: 242)
Name: NF6865A_low_212
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_212 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 59 - 223
Target Start/End: Complemental strand, 35309652 - 35309487
Alignment:
| Q |
59 |
aactctaatcaagttgctgtccatgcatacaacta-gagtgaaatattggtcaaactaataactgtcatatagtgttaatgattagtacttgtgctgaat |
157 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35309652 |
aactctaatcaagttgatgtccatgcatacaactatgagtgaaatattggtcaaactaataactgtcatataatgttaatgattagtacttgtgctgaat |
35309553 |
T |
|
| Q |
158 |
ggttgattggagtttttgcatgccacgctatttcttttttgaataagaacagatgccacgctggat |
223 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35309552 |
ggatgattggagtttttgcatgccacgctatttcttttttgaataagaacatatgccacgctggat |
35309487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 59 - 208
Target Start/End: Complemental strand, 35325875 - 35325725
Alignment:
| Q |
59 |
aactctaatcaagttgctgtccatgcatacaactagagtgaaatattggtcaaactaataactgtcata-tagtgttaatgattagtacttgtgctgaat |
157 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
35325875 |
aactctaatcaagttgctgtctatgcatgcaactagagtgaaatattggtcaaactaataactgtcatattagtgttaatgattagtacttatgccgaat |
35325776 |
T |
|
| Q |
158 |
ggttgattggagtttttgcatgccacgctatttcttttttgaataagaaca |
208 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
35325775 |
ggatgattggagtttttgcatgccacgctatttcctttttgggtaagaaca |
35325725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University