View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_222 (Length: 240)
Name: NF6865A_low_222
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_222 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 7723155 - 7723366
Alignment:
| Q |
21 |
attactctttttcacaaagaatgatgcatcgttcatctcaagggcaacacgtgatgggacactgttcatgtggtatgtttcatggacaaaacaactcatt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723155 |
attactctttttcacaaagaatgatgcatcgttcatctcaagggcaacacgtgatgggacactgttcatgtggtatgtttcatggacaaaacaactcatt |
7723254 |
T |
 |
| Q |
121 |
ctcaatgttattctcctcctctacaccttatgatcatgaacctgaaacatattgcttcactccgaattcttcatcttcttctgttgattgtactctttca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7723255 |
ctcaatgttattctcctcctctacaccttatgatcatgaacctgaaacatattgcttcactcctaattcttcatcttcttctgttgattgtactctttca |
7723354 |
T |
 |
| Q |
221 |
cttggaacacca |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7723355 |
cttggaacacca |
7723366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University