View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_229 (Length: 238)
Name: NF6865A_low_229
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_229 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 230
Target Start/End: Original strand, 2539350 - 2539561
Alignment:
| Q |
19 |
catcacagcatacattcttcttgtttgttcacttactgcctgggctggtaaaagttcgtgattatgctccttcacaaagctatgaatgacccatttccca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2539350 |
catcacagcatacattcttcttgtttgttcacttactgcctgggctggtaaaagttcgtgattatgctccttcacaaagctatgaatgacccatttccca |
2539449 |
T |
|
| Q |
119 |
tcttgccttctttttacatgcatgcttgctttacagtcggtcttatcgcaagatactcgtccagttgaattttcagcttattacttgttctgtcgcgctc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |||||||||||||||| || || |||||||||||| |||| |
|
|
| T |
2539450 |
tcttgccttctttttacatgcatgcttgctttacagtcggtcttagagcaagatcttcgaccagttgaattttcagattcttgcttgttctgtcgagctc |
2539549 |
T |
|
| Q |
219 |
gttgacggttga |
230 |
Q |
| |
|
|| | ||||||| |
|
|
| T |
2539550 |
gtggtcggttga |
2539561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 153
Target Start/End: Original strand, 42012653 - 42012741
Alignment:
| Q |
65 |
ggtaaaagttcgtgattatgctccttcacaaagctatgaatgacccatttcccatcttgccttctttttacatgcatgcttgctttaca |
153 |
Q |
| |
|
|||||||| || |||||||||| ||| ||||| |||| || |||||| ||||| || ||||| ||||||||||| ||||||||||| |
|
|
| T |
42012653 |
ggtaaaagctcatgattatgctgcttaacaaaactataaacataccatttaccatcctgtcttctctttacatgcatacttgctttaca |
42012741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University