View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_243 (Length: 232)
Name: NF6865A_low_243
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_243 |
 | |
|
| [»] scaffold0054 (2 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 24415430 - 24415238
Alignment:
| Q |
1 |
gaacagtagaggtgagaatcgataatagattggaaaaccatgatatctaaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttct |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24415430 |
gaacaatagaggtgagaatcgataatagattggtaaaccatgatatgtaaaagcaaaatagtaaattggaaacaaaccaaaactaaaactgtcactttct |
24415331 |
T |
|
| Q |
101 |
tattatgagccttttttcatcttcaaaggtagtattattatacttatttatttttgatgcatttcccgttttcattttggtactagcctatga |
193 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24415330 |
tattatgacccttttttcatcttccaaggtagtattattatacttatttatttttgatgcatttcccgttatcattttggtactagcctatga |
24415238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 126 - 192
Target Start/End: Complemental strand, 42545 - 42480
Alignment:
| Q |
126 |
aaggtagtattattatacttatttatttttgatgcatttcccgttttcattttggtactagcctatg |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42545 |
aaggtagtagtattatacttatttattttt-atgcatttcccgttttcattttggtactagcctatg |
42480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 103
Target Start/End: Complemental strand, 38206 - 38163
Alignment:
| Q |
60 |
agtaaattggaaacaaaccaaaactaaaactgtcactttcttat |
103 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
38206 |
agtaaattggaaacaaacacaaattaaaactgtcactttcttat |
38163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 198 - 231
Target Start/End: Complemental strand, 36086048 - 36086015
Alignment:
| Q |
198 |
attcaactgaatttgatgatgaatttctgatttg |
231 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
36086048 |
attcaactgaatttgatgatgagtttctgatttg |
36086015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University