View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_258 (Length: 230)
Name: NF6865A_low_258
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_258 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 70 - 230
Target Start/End: Original strand, 18518464 - 18518626
Alignment:
| Q |
70 |
tatgagagagaaaattgtcgcattttatctcaatcatttatccttgttgtccctctccttgttcatttatgtct--acgtttaaaattgatggaatttat |
167 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18518464 |
tatgagagagaaagttgtcgcattttatctcaatcatttatccttgttgtccctctccttgttcatttatgtctttacgtttaaaattgatggaatttat |
18518563 |
T |
 |
| Q |
168 |
aaaaacttcaacatttccatgtgtgtcggtcttaaaatcattctggactacaggggggcctga |
230 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18518564 |
aaaaactccaacatttccatgtgtgtcggtcttaaaatcattctggactacaggggggcctga |
18518626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University