View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_261 (Length: 230)
Name: NF6865A_low_261
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_261 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 2539621 - 2539851
Alignment:
| Q |
1 |
aattctcttgaggtttt-gaacggcgactattttgtattgcagtgttgaatcccattgatcgagcatattcttggtagaaagaataagcttccccatgag |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2539621 |
aattctcttgaggtttttgaacggcgactattttgtattgcagtgttgaatcccattgatcgagcatattcttggtagaaagaataagcttccccatgag |
2539720 |
T |
 |
| Q |
100 |
actcaaattccataccagaaagtggctcaagatttgtatcttccttaaacattgcaatatcaactgt-ggggaattcagatctccaccatttagagcatg |
198 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2539721 |
actcgaattccataccagaaagtggctcaagatttgtatcttccttaaacattgcaatatcaactgtgggggaattcagatctccaccatttagagcatg |
2539820 |
T |
 |
| Q |
199 |
tacctcaatgccagcttcaaccatatgtctg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
2539821 |
tacctcaatgccagcttcaaccatatgtctg |
2539851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University