View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_263 (Length: 230)
Name: NF6865A_low_263
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_263 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 68 - 230
Target Start/End: Complemental strand, 27430584 - 27430420
Alignment:
| Q |
68 |
ttttacgagtttaattaagcactaacttcactatttgaacacattatcatgttaattattgattttcaaattaattaattttcactatgggaatatatat |
167 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430584 |
ttttacgagtttaattaagcacaaacttcactatttgaacaaattatcatgttaattattgattttcaaattaattaattttcactatgggaatatatat |
27430485 |
T |
|
| Q |
168 |
ttattt--atatgctttgcaggaactattacaggtgcactcacaaacatgatcaaggttgcaaag |
230 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430484 |
ttatttatatatgctttgcaggaactattacaggtgcactcacaaacatgatcaaggttgcaaag |
27430420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 180 - 230
Target Start/End: Complemental strand, 27447717 - 27447667
Alignment:
| Q |
180 |
tttgcaggaactattacaggtgcactcacaaacatgatcaaggttgcaaag |
230 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
27447717 |
tttgcaggaactattacagatgcactcacaaaaatgatcaaggttgcaaag |
27447667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 27430645 - 27430594
Alignment:
| Q |
1 |
tcaatggagaaagtatgggcnnnnnnngatcttgcacaccgattttccaagg |
52 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27430645 |
tcaatggagaaagtatgggcaaaaaaagatcttgcacaccgattttccaagg |
27430594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University