View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_267 (Length: 230)
Name: NF6865A_low_267
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_267 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 24 - 212
Target Start/End: Complemental strand, 7899486 - 7899298
Alignment:
| Q |
24 |
atacatctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcaatgacacttctatct |
123 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7899486 |
atacagctcacgcgtggttgacttgatccgacacatggcttcagttggttaatgtgcaaggagtttttggcatacatctagtgcaatgacacttctatct |
7899387 |
T |
 |
| Q |
124 |
tacaaatcaagcattcagtaaagtagatttttggaataattttgcttctgttaaatgacgagaatattgttccacacaacttgattcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7899386 |
tacaaatcaagcattcagtaaagtagatttttggaataattttgcttctgttaaatgacgagaatattgttccacacaacttaattcat |
7899298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University