View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_271 (Length: 229)
Name: NF6865A_low_271
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_271 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 56 - 229
Target Start/End: Complemental strand, 38552756 - 38552590
Alignment:
| Q |
56 |
attaagccttattgatggtctgtctagtttattactttttctggtatagatattgtgatctattcaattcaggttggagattttccaagtcaataaa-ca |
154 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | || |
|
|
| T |
38552756 |
attaagccttattgatggtct----agtttattactttttctggtatagatattgtgatctattca-----ggttggagattttccaagtcaattgatca |
38552666 |
T |
|
| Q |
155 |
ttgtttgtaaataatttgtgaaata-tcaagattgtatttgaatttgagatttaagtatttttatatattaagcaa |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38552665 |
atgtttgtaaataatttgtgaaataatcaagattgtatttgaatttgagatttaagtatttttatatattaagcaa |
38552590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University