View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_275 (Length: 229)
Name: NF6865A_low_275
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_275 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 13 - 193
Target Start/End: Original strand, 25742021 - 25742201
Alignment:
| Q |
13 |
gactgaaatgaaacgttggggagtattggtggaatgagttttttgttttggtagcattggatgtattggtagggcttaccggcgactatgccgcagatgg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742021 |
gactgaaatgaaacgttggggagtattggtggaatgagttttttgttttggtagcattggatgtattggtagggcttaccggcgactatgccgcagatgg |
25742120 |
T |
|
| Q |
113 |
tggaggtgttgtggatgatggcgggagtggtggcggggcggaggctggtgacggaggttttgggggaaattaaggggaaaa |
193 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || ||||||| |||||| |||| ||| | |||| |||| ||||| |
|
|
| T |
25742121 |
tggaggtgttgtggatgatggcggtagtggtggcggtgccgaggctgttgacggtggttatggtgaaaatgaaggagaaaa |
25742201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University