View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_282 (Length: 228)
Name: NF6865A_low_282
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_282 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 34 - 228
Target Start/End: Complemental strand, 28250022 - 28249828
Alignment:
| Q |
34 |
cacagcggttttcacaccgggagaactcaaacaatcattctccgtccctatgctgcgtgtggcgaaaaccgtcgatatgtacctcgctgaaagcgccgcg |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
28250022 |
cacagcggttttcacaccgggagaactcaaacaatcattctccgtccctatgctgcgtgtggcgaaaaccgtcgacatgtacctcgctgaaatcgccgcg |
28249923 |
T |
|
| Q |
134 |
tacggtgaactcagcatctcaaaattcaacggaatcgctgttcttattcctaaacacgcgcgtaaaatcgacgatgatctttaccgcgccgttga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249922 |
tacggtgaactcagcatctcaaaattcaacggaatcgctgttcttattcctaaacacgcgcgtaaaatcgacgatgatctttaccgcgccgttga |
28249828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University