View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_299 (Length: 224)
Name: NF6865A_low_299
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_299 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 34 - 177
Target Start/End: Complemental strand, 1045539 - 1045396
Alignment:
| Q |
34 |
aacctaaaatgaaactgagaagacgatgaatactactatcgatctaaaaatatgatttttcttgtgaaataagttttttagttagattttgatggtaaaa |
133 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045539 |
aaccgaaaatgaaactgagaagacgatgaatactactatcgatctaaaaatatgatttttcttgtgaaataagttttttagttagattttgatggtaaaa |
1045440 |
T |
 |
| Q |
134 |
ttaatattttattgattgtaaataatgtaacaattttatagagt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045439 |
ttaatattttattgattgtaaataatgtaacaattttatagagt |
1045396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 175 - 217
Target Start/End: Complemental strand, 18569081 - 18569039
Alignment:
| Q |
175 |
agtgaaattaaataggtggattctagggtgaaggttctattaa |
217 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
18569081 |
agtgtaattatataggtggattctagggtgaaggtcctattaa |
18569039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 188 - 224
Target Start/End: Complemental strand, 24848475 - 24848439
Alignment:
| Q |
188 |
aggtggattctagggtgaaggttctattaagtgcctc |
224 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
24848475 |
aggtggattctagggtgagggttctattaagtccctc |
24848439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University