View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_302 (Length: 224)
Name: NF6865A_low_302
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_302 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 44231872 - 44232090
Alignment:
| Q |
1 |
acacaatcaatacaaaacaaatttcattactgccaaaagtttccatcctagcactatcttttttatgtgaatttatgtaagtacattatcaaagattgca |
100 |
Q |
| |
|
|||||||||||||||| | || |||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44231872 |
acacaatcaatacaaatctaagttcactactgccaaaagtttccatcctagcactatcttttttatgtgaattgatgtaagtacattatcaaagattgca |
44231971 |
T |
 |
| Q |
101 |
tattttggacttgtgcatgtgaattttggacttgtgcatgtgatgtgactcttgtgtatggccaaaaccaggaaagtattgcaatagttttgttggttgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44231972 |
tattttggacttgtgcatgtgaattttggacttgtgcatgtgatgtgcctcttttgtatggccaaaaccaggaaagtatggcaatagttttgttggttgt |
44232071 |
T |
 |
| Q |
201 |
atttattaatgaacttagt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
44232072 |
atttattaatgaacttagt |
44232090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University