View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_315 (Length: 220)
Name: NF6865A_low_315
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_315 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 202
Target Start/End: Original strand, 31741369 - 31741551
Alignment:
| Q |
20 |
attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741369 |
attagatgctcgatgaaacttttttcgttgagacaaatttcactagttatgaaatgatacacacatactaggaaatagtatattatgatttgagcttaca |
31741468 |
T |
 |
| Q |
120 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31741469 |
aacattgtaactgtcacatgagaatcgttgtacaatatgctatttatagacttcaactttaggaatctgttgcacacattcat |
31741551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University