View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_324 (Length: 216)
Name: NF6865A_low_324
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_324 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 22 - 195
Target Start/End: Complemental strand, 6412188 - 6412015
Alignment:
| Q |
22 |
ttatggtttggaatgtgtggaaaacacaaatagttttatttctatttctaaatattttaagctcacacatgatcatattattatttctattttcgtggaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412188 |
ttatggtttggaatgtgtggaaaacacaaataattttatttctatttctaaatattttaagctcacacatgatcatattattatttctattttcgtggaa |
6412089 |
T |
|
| Q |
122 |
tgtgattctcaagttattatttagattgcttagtgcacttcaacttatatcgtgacagttaaacccctcttact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||| ||||||||||| |
|
|
| T |
6412088 |
tgtgattctcaagttattatttagattgtttagtgcacttcaactcatatcgtgacacttaagcccctcttact |
6412015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 76 - 171
Target Start/End: Complemental strand, 10738392 - 10738297
Alignment:
| Q |
76 |
ttttaagctcacacatgatcatattattatttctattttcgtggaatgtgattctcaagttattatttagattgcttagtgcacttcaacttatat |
171 |
Q |
| |
|
||||||||| ||||||||||| ||||||| || || | |||||||||||||||||| | ||||| ||||| ||||| ||| |||||||||||| |
|
|
| T |
10738392 |
ttttaagcttgcacatgatcatgatattattgctcttcttgtggaatgtgattctcaatctgttattcagattacttagagcatttcaacttatat |
10738297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 166
Target Start/End: Complemental strand, 33232032 - 33231944
Alignment:
| Q |
78 |
ttaagctcacacatgatcatattattatttctattttcgtggaatgtgattctcaagttattatttagattgcttagtgcacttcaact |
166 |
Q |
| |
|
|||||||| ||| |||||| | || || ||||||| |||| ||| ||||||||| ||| |||||||||||| || ||||||||||||| |
|
|
| T |
33232032 |
ttaagctcgcacgtgatcagaataatacttctattctcgtaaaatttgattctcatgtttttatttagattgtttggtgcacttcaact |
33231944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University