View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_325 (Length: 215)
Name: NF6865A_low_325
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_325 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 76 - 192
Target Start/End: Complemental strand, 9462349 - 9462216
Alignment:
| Q |
76 |
cttctgcgtagttttctgcatcaggtgctacagttttaattaaatgaataaac-----------------aattgttcaagttcattagttgttaatcat |
158 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||| |
|
|
| T |
9462349 |
cttctgcatagttttctgcatcaggtgctacagttttaattaaatgaataaacctgcaagcaacattaataattgttcaagttgattatttgttaatcat |
9462250 |
T |
 |
| Q |
159 |
cttagtttgagatctcagaattattcactctact |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9462249 |
cttagtttgagatctcagaattattcactctact |
9462216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 9462391 - 9462363
Alignment:
| Q |
22 |
gtcataacagaaatgatcgcttagcgagc |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9462391 |
gtcataacagaaatgatcgcttagcgagc |
9462363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University