View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_339 (Length: 209)
Name: NF6865A_low_339
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_339 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 25 - 209
Target Start/End: Original strand, 31997902 - 31998086
Alignment:
| Q |
25 |
tccaacaatatgcctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatt |
124 |
Q |
| |
|
||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31997902 |
tccaagaaaatgcctcgtggacgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgctaaatt |
31998001 |
T |
|
| Q |
125 |
tcatggtaacagttggtttgtttatctttctggctctgcataagaattggattttaannnnnnnaatcaaagtcttttgacctat |
209 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31998002 |
tcttggtcacagttggtttgtttatctttctggctctgcataagaattggattttaatttttttaatcgaagtcttttgacctat |
31998086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 37 - 119
Target Start/End: Original strand, 15843038 - 15843120
Alignment:
| Q |
37 |
cctcgtggatgtggacttgcataataggaggtggtctttctggagggaaaaatgtgcctctggaaggaagtatattagctgct |
119 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||| |||||||||||||| ||||||| |||| ||||| |
|
|
| T |
15843038 |
cctcgtggatgtggacttgcatagtaggagatggtcttgttggagggggcaatgtgcctctggagggaagtacattacctgct |
15843120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University