View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_362 (Length: 201)
Name: NF6865A_low_362
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_362 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 56169081 - 56169281
Alignment:
| Q |
1 |
tacctgtttattatatttctaacaaaaattgataattttagatgacaatcttttgattggtcttgttatttggcattaacttttgtcttatgcctattat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
56169081 |
tacctgtttattatatttctaacaagaattgataattttagatgacaatcttttgattggtcttgttatttggcattaacgtttgtcttatgcctattat |
56169180 |
T |
|
| Q |
101 |
gatataatgctttttatcatttctctttagtgtttgtcttttatgattttgtttatcactttctctaggctgtgctaacctattttatgtaaatttgctg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56169181 |
gatataatgctttttatcatttcactttagtgtttgtcttttatgattttgtttatcactttctctaggctgtgctaacctattttatgtaaatttgctg |
56169280 |
T |
|
| Q |
201 |
a |
201 |
Q |
| |
|
| |
|
|
| T |
56169281 |
a |
56169281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 706633 - 706522
Alignment:
| Q |
1 |
tacctgtttattatatttctaacaaaaattgataattttagatgacaatcttttgattggtcttgttatttggcattaacttttgtcttatgcctattat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||| |||||| |||||| |
|
|
| T |
706633 |
tacctgtttattatatttctaacaagaattgatagttttagatgacaatcttttgattggtcttgttatttggtgttaatctttgttttatgcttattat |
706534 |
T |
|
| Q |
101 |
gatataatgctt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
706533 |
gatataatgctt |
706522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University