View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_48 (Length: 366)
Name: NF6865A_low_48
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 17 - 362
Target Start/End: Complemental strand, 49133327 - 49132989
Alignment:
| Q |
17 |
acatcaatgatgaaaattgttcaccaactttggatcaagtaaagtaatggatagacacacagctaaatctggtgaagaacaatgataaaatgttacagaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133327 |
acatcaatgatgaaaattgttcaccaactttggatcaagtaaagtaatggatagacacacagctaaatctggtgaagaacaatgataaaatgttacagaa |
49133228 |
T |
|
| Q |
117 |
catgttctatttcttcgacaggataacatattcttataaatcaagcaattcgaccatcaacattctcaggcatgcctcttccttcatgatgaccaccatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
49133227 |
catgttctatttcttcgacaggataacatattcttataaatcaagcaattcgaccatcaatattctcaggcatgccttttccttcatgatgaccaccatc |
49133128 |
T |
|
| Q |
217 |
nnnnnnnnnnnnnnnctttaagttccaatcttagctaattcctcctcatgctttccattggcttttggtgagaggtggagtgagtgatttctctcgtcat |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133127 |
ttttttttt-------tttaagttccaatcttagctaattcctcctcatgctttccattggcttttggtgagaggtggagtgagtgatttctctcgtcat |
49133035 |
T |
|
| Q |
317 |
ccaagtggtgttcatgtttgttacaatgacggcggcggtgatggtg |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133034 |
ccaagtggtgttcatgtttgttacaatgacggcggcggtgatggtg |
49132989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University