View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_58 (Length: 355)
Name: NF6865A_low_58
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 4e-94; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 155 - 341
Target Start/End: Complemental strand, 18806630 - 18806444
Alignment:
| Q |
155 |
atcattttctattctccctggcttatgacatttcttcctaaattcgaccatgatttcttgtcgtctgcaaatagacgcattcataagtcattcgtgatcg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18806630 |
atcattttctattctccctggcttatgacatttcttcctaaattcgaccatgatttcttgtcgtctgcaaatagacgcattcataagtcattcgtgatcg |
18806531 |
T |
 |
| Q |
255 |
ttaaattgagattggatatgtaaaaaattaacataaatatgttttgatctggttggatctaagaaaatggttgattggttgatgtcc |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18806530 |
ttaaattgagattggataggtaaaaaattaacataaatattttttgatctggttggatctaagaaaatggttgattggttgaggtcc |
18806444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 18 - 164
Target Start/End: Complemental strand, 18807902 - 18807756
Alignment:
| Q |
18 |
acatcacgcatattgaatcgtatattcttcacgattccatcaactagccttaattaattggaacgtggagattagatgctagtacagtaagagctcgtgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18807902 |
acatcacgcatattgaatcgtatattcttcacgattccatcaactagccttaattaattggaacgtggagattagatgccagtacagtaagagctcgtgc |
18807803 |
T |
 |
| Q |
118 |
atgccaggcatcggctcgtgctgaacgtttgaggtctatcattttct |
164 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18807802 |
atgccatgcatcggctcgtgctgaacgtttgaggtctatcattttct |
18807756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 52 - 123
Target Start/End: Complemental strand, 18797797 - 18797726
Alignment:
| Q |
52 |
ttccatcaactagccttaattaattggaacgtggagattagatgctagtacagtaagagctcgtgcatgcca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
18797797 |
ttccatcaactagccttaattaattggaacgtggagattagatgccagtacagtaagagctcgtgtatgcca |
18797726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University