View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_78 (Length: 327)
Name: NF6865A_low_78
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_78 |
 |  |
|
| [»] scaffold0048 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0048 (Bit Score: 149; Significance: 1e-78; HSPs: 1)
Name: scaffold0048
Description:
Target: scaffold0048; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 103 - 315
Target Start/End: Complemental strand, 16343 - 16131
Alignment:
| Q |
103 |
tcacaacatcacactgacgatatcaaccagcacatccctcccataaaacaactacatccaataactaatttgcccagaaatactgctcaacttgaaaagc |
202 |
Q |
| |
|
|||||||||||||||| |||||||||||| || ||||||||||||||||||||| ||||| | ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16343 |
tcacaacatcacactgctgatatcaaccaggacttccctcccataaaacaactacttccaaaatctaatttgcccagaaatacaactcaacttgaaaagc |
16244 |
T |
 |
| Q |
203 |
tggtccatcttcaccggtgcttgtcaagggaggcactgcagtccggagaaccaacattggaggagggcacatgaaaactatcttattgttagctgcctca |
302 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16243 |
tggtccatcttcaccggtgcttgtggagggaggtactgcagtccggagaaccaacatcggaggagggcacatgaaaacgatcctattgttagctgcctca |
16144 |
T |
 |
| Q |
303 |
gtaacaccaaact |
315 |
Q |
| |
|
|| |||||||||| |
|
|
| T |
16143 |
gttacaccaaact |
16131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University