View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_8 (Length: 494)
Name: NF6865A_low_8
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 17 - 367
Target Start/End: Original strand, 4048211 - 4048565
Alignment:
| Q |
17 |
catcatctttcatcacactactaataatc----tgtcacgagcacagacaatagagtgcagctgctgctgctccacctgccggccgtcatttcacacttc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048211 |
catcatctttcatcacactactaataatcaatctgtcacgagcacagacaatagagtgcagctgctgctgctccacctgccggccgtcatttcacacttc |
4048310 |
T |
|
| Q |
113 |
tgctctgccatcactcactgatttgacccttcttccatgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtacctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048311 |
tgctctgccatcactcactgatttgacccttcttccctgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtacctt |
4048410 |
T |
|
| Q |
213 |
ggttatagtccaattttgtgggacccacttagggtagatgataacgtggcgtgtttctgatgagtagccccatcaccaaagaatctgtcggcagcagaga |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048411 |
ggttatagtccaattttgtgggacccacttagggtagattataacgtggcgtgattctgatgagtagccccatcaccaaagaatctgtcggcagcagaga |
4048510 |
T |
|
| Q |
313 |
cgtcacgctgttctttcttacattattacccacacgcaaacatcaacaacacttt |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4048511 |
cgtcacgctgttctttcttacattattacccacacgctaacatcaacaacacttt |
4048565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 429 - 494
Target Start/End: Original strand, 4048627 - 4048692
Alignment:
| Q |
429 |
gaatagtgttggtctttctttctttagttgttctccgtctacctctcgtcgttgtcgatgttgttg |
494 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048627 |
gaatagtgttggtctttctttcattagttgttctccgtctacctctcgtcgttgtcgatgttgttg |
4048692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University