View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6865A_low_86 (Length: 315)
Name: NF6865A_low_86
Description: NF6865A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6865A_low_86 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 12 - 177
Target Start/End: Original strand, 32907352 - 32907519
Alignment:
| Q |
12 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttat--cctatattatgtgtgaaccactcaataatcctcccattaattgtcactcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32907352 |
atgaatgaataaatcaatgaaaatcctgacaaaatactctcactttatatcctatattatgtatgaaccactcaataatcctcccactaattgtcactcc |
32907451 |
T |
|
| Q |
110 |
tctcttggttggcaaatcagcagaattgttggcttccctattcactcctctcttttgtattttctgtc |
177 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32907452 |
tctcttggttagcaaatcagcagaattgttggcttccctgttcactcctctcttttgtattttctgtc |
32907519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 189 - 308
Target Start/End: Original strand, 32907578 - 32907697
Alignment:
| Q |
189 |
aatgtagcatgtcttaaaacttaatatattaaaccttatatggagggtattctgccattggatggatttgcttccaggtaactgtaatgaaatactactg |
288 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32907578 |
aatgtagcatgtcttaaaacttaatgtattaaactttatatggagggtattcttccattggatggatttgcttccaggtaattgtaatgaaatactactg |
32907677 |
T |
|
| Q |
289 |
gctttacactattgaaatct |
308 |
Q |
| |
|
|||||| ||||| ||||||| |
|
|
| T |
32907678 |
gctttatactatcgaaatct |
32907697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University