View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_high_22 (Length: 207)
Name: NF6866A_high_22
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_high_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 38892962 - 38892756
Alignment:
| Q |
1 |
gtcactagttgccttctgtttctctcttcttgccttccctgcaaaaagtggacccaagaataagaattgattaaatgagtcatctttattttgaattggt |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892962 |
gtcactagtttccttctgtttctctcttcttgccttccctgcaaaaagtggaaccaagaataagaattgattaaatgagtcatctttattttgaattggt |
38892863 |
T |
 |
| Q |
101 |
tcaaatgtgagcgtaattaatcaaactaaaatgttatcaaatgaaatcaaccaataataattacaccatgaattgtaccatcgcatcggaaattgaccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38892862 |
tcaaatgtgagcgtaattaatcaaactaaaatgttatcaaatgaaatcaaccaataataattacaccatgaattgtaccatcgcatcggaaattgaccct |
38892763 |
T |
 |
| Q |
201 |
ctacaac |
207 |
Q |
| |
|
||||||| |
|
|
| T |
38892762 |
ctacaac |
38892756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University