View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_high_23 (Length: 207)
Name: NF6866A_high_23
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_high_23 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 8452643 - 8452852
Alignment:
| Q |
1 |
aatgagtgcaaattgagaagcatgcgtcaaaatggctcttgaatctagatagaattttatcttattttaagtagttgcaaattaagcaggtgcattagtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8452643 |
aatgagtgcaaattgagaagcatgcgtcaaaatggctc--gaatctagatagaattttatcttattttaagttgttgcaaattaagcaggtgcattagtc |
8452740 |
T |
 |
| Q |
101 |
ttatgcca---tagtagatagatatataaaatgagtccctatagtctctgcaggtgcattttatac--atatcaaaattacaggtgtgtattcttcattt |
195 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
8452741 |
ttatgccatactagtagatagatatataaaatgagtccctatagtctctgcaggtgcattttatacatatatcaaaattacaggtgtgtattattcattt |
8452840 |
T |
 |
| Q |
196 |
tatgctgacaaa |
207 |
Q |
| |
|
| |||||||||| |
|
|
| T |
8452841 |
tctgctgacaaa |
8452852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University