View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_111 (Length: 320)
Name: NF6866A_low_111
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_111 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 84; Significance: 7e-40; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 197 - 309
Target Start/End: Original strand, 30734895 - 30735009
Alignment:
| Q |
197 |
tttatgacatgtctatcaaacagaattta--gtgatgcaatcaaacaaaaagaaatattcataatagaagcatgcaacatcacgatgatatcgatataat |
294 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
30734895 |
tttatgacatgtctatcaaacggaatttatagtgttgcaatcaaacaaaaagaaatattcataatagaagcatgcaacatcacgatgacattgatataat |
30734994 |
T |
|
| Q |
295 |
caaagccaacaaaca |
309 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
30734995 |
gaaagccaacaaaca |
30735009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 29 - 91
Target Start/End: Original strand, 30715916 - 30715978
Alignment:
| Q |
29 |
attggtgtttattaatcagtattgtagatattgtcaatacatgtagtggtgttgtcctagttt |
91 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
30715916 |
attggtgtttattaatcaatattgtagatattgttaatatatgtagtggtgttgtcctagttt |
30715978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 62 - 120
Target Start/End: Original strand, 30734369 - 30734427
Alignment:
| Q |
62 |
tcaatacatgtagtggtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggt |
120 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
30734369 |
tcaatatatgtagtggtgttgtcctagtttaaattgtgctcaaaatgaatatggtgggt |
30734427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 77 - 145
Target Start/End: Original strand, 30716028 - 30716097
Alignment:
| Q |
77 |
gtgttgtcctagtttaaatcgtgctcaaaatttatatggtgggtgttgatgagtttg-aatatgatgatc |
145 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
30716028 |
gtgttgtcctagtttaaattgtgctcaaaatgaataaggtgggtgttgatgaatttgaaatatgatgatc |
30716097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University