View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_128 (Length: 305)
Name: NF6866A_low_128
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_128 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 5 - 299
Target Start/End: Original strand, 31441214 - 31441508
Alignment:
| Q |
5 |
gaattcgggagaaaatactagaaaaattgatgagttttgagataggatggtttgatcatgaagacaacacaagtgcagctatttgtgcaagattagcctc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441214 |
gaattcgggagaaaatactagaaaaattgatgagttttgagataggatggtttgatcatgaagacaacacaagtgcagctatttgtgcaagattagcctc |
31441313 |
T |
|
| Q |
105 |
agaagccaacttggtccgttcactcgttggcgaccggatgtctcttctggctcaagcaatctttggatccatctttgcttacactgtaggacttgtgctc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441314 |
tgaagccaacttggtccgttcactcgttggcgaccggatgtctcttctggctcaagcaatctttggatccatctttgcttacactgtaggacttgtgctc |
31441413 |
T |
|
| Q |
205 |
acatggaggctttctcttgtgatgattgcagtacagccattagtcattggaagcttttatgcaagaagtgttttgatgaagactatggcggaaaa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31441414 |
acatggaggctttctcttgtgatgattgcagtacagccattagtcattggaagcttttatgcaagaagtgttttgatgaagactatggcggaaaa |
31441508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 40 - 82
Target Start/End: Original strand, 39156431 - 39156473
Alignment:
| Q |
40 |
tttgagataggatggtttgatcatgaagacaacacaagtgcag |
82 |
Q |
| |
|
||||||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
39156431 |
tttgagataggatggtttgatcaagaggagaacacaagtgcag |
39156473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University