View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_170 (Length: 275)
Name: NF6866A_low_170
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_170 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 138 - 262
Target Start/End: Original strand, 37487797 - 37487921
Alignment:
| Q |
138 |
cttttaattaattttattactggacagaattttgatgctatctcccctccgagaattgcaggattagttggttgtatagtaccccttcccatcaacgatg |
237 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
37487797 |
cttttaattgattttgttactggacagaattttgatgctattgcccctccgagaattgcaggattagttggttgtatagtacccattcccatcaatgatg |
37487896 |
T |
|
| Q |
238 |
atcttcgccttcaactcactcccct |
262 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37487897 |
atcttcgccttcaactcactcccct |
37487921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 62 - 116
Target Start/End: Original strand, 37487724 - 37487778
Alignment:
| Q |
62 |
cattttgctttcggtttttcgtttggctttcaatttcatgttttgcttgtgatac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37487724 |
cattttgctttcggtttttcgtttggctttcaatttcatgtttcacttgtgatac |
37487778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University