View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_180 (Length: 269)
Name: NF6866A_low_180
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_180 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 38322858 - 38322605
Alignment:
| Q |
1 |
tagaaactcttgctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcatcactttcgacaagtcgatatccttt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38322858 |
tagaaactctttctatcacttcaatctctgaaggatggactttagattctgaaattgaggcatttatttgagcattactttcgacaagtcgatatccttt |
38322759 |
T |
 |
| Q |
101 |
gttttctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatttagtatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38322758 |
gttttctttcagctgcacaaatacattcaacattatttgctactattaattaataagatcataagttcataaatatgattacattgaccatatagtatag |
38322659 |
T |
 |
| Q |
201 |
aaaaatgaacctgcactttttgccaatcagggttgtactttatggctaacacat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322658 |
aaaaatgaacctgcactttttgccaatcagggttgtactttatggctaacacat |
38322605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University