View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_200 (Length: 257)
Name: NF6866A_low_200
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_200 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 8 - 253
Target Start/End: Original strand, 5739480 - 5739725
Alignment:
| Q |
8 |
ttggagtttatgtggcttcttggcgtttttgtttccatctttgtgtnnnnnnnctagctttacttaactattcataattatttcttttttctaacaatgg |
107 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5739480 |
ttggactttatgtggcttcttggtgtttttgtttccatctttgtgtaaaaaaactagctttacttaactattcataattatttcttttttctaacaatgg |
5739579 |
T |
|
| Q |
108 |
cagctgccagagaaactaccacactttccaaaatcaagaggcttcatcaacaaaaacaacaaatacagaagcttcctccttgatgaaaatggaggcagat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5739580 |
cagctgccagagaaactaccacactttccaaaatcaagaggcttcatcaacaaaaacaacaaatacagaggcttcctccttgatgaaaatggaggcagat |
5739679 |
T |
|
| Q |
208 |
ttgtaaattgaatagccattctcggctgattgatgttggtgttact |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5739680 |
ttgtaaattgaatagccattctcggctgattgatgttggtgttact |
5739725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University