View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_213 (Length: 251)
Name: NF6866A_low_213
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_213 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 9 - 137
Target Start/End: Original strand, 8452397 - 8452525
Alignment:
| Q |
9 |
gagatgaagagaacaagttaagtccatttttgaatgcaagttcagattgcagtgatattgggatatgcgtatttgaaaaatgaagcaagaagaaattaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8452397 |
gagatgaagagaacaagttaagtccatttttgaatgcaagttcagattgcagtgatattgggatatgcgtatttgaaaaatgaagcaagaagaaattaat |
8452496 |
T |
 |
| Q |
109 |
aaccattttatttgtactagtactagtag |
137 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
8452497 |
aaccattttatttgtactagtattagtag |
8452525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 208 - 251
Target Start/End: Original strand, 8452596 - 8452639
Alignment:
| Q |
208 |
ttttgtaaaaatatgtgtggaagaattaaattttctctgccctt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8452596 |
ttttgtaaaaatatgtgtggaagaattaaattttctctgccctt |
8452639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University