View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_228 (Length: 249)
Name: NF6866A_low_228
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_228 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 2 - 126
Target Start/End: Original strand, 37372180 - 37372304
Alignment:
| Q |
2 |
atggacatcactcaagaccgcaccaaaataatgttatgtacatacaaaacctataaattttgcattaaggaaataaatgagatggatggtagtcaaatta |
101 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37372180 |
atggacctcactcaagaccgcaccaaaataatgttatgtacatacaagacctataaattttgcattaaggaaataaatgagatggatggttgtcaaatta |
37372279 |
T |
|
| Q |
102 |
acagtggcaagtggagatttaggaa |
126 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37372280 |
ctagtggcaagtggagatttaggaa |
37372304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 145 - 249
Target Start/End: Original strand, 37372290 - 37372395
Alignment:
| Q |
145 |
gtggagatttaggaaaactacaagagaaaatattataaaa-ttttagagattgatgagttcgagaatgatgtgatatatgacataatattatagtttcat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| | || |
|
|
| T |
37372290 |
gtggagatttaggaaaactacaagagaaattattataaaagttttagagattgatgagttcgagagtgatgtgatatatgacataatattatagtgttat |
37372389 |
T |
|
| Q |
244 |
ttgatt |
249 |
Q |
| |
|
|||||| |
|
|
| T |
37372390 |
ttgatt |
37372395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University