View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_244 (Length: 247)
Name: NF6866A_low_244
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_244 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 227
Target Start/End: Complemental strand, 33791189 - 33790971
Alignment:
| Q |
9 |
agatggacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgcta |
108 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33791189 |
agatgtacatcattaacagttgatactaatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaacagaatctcttgttgcta |
33791090 |
T |
 |
| Q |
109 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33791089 |
atgatattatgtctgcacatgaaactgttgatggacatgcattttctaggattcttttgatttcatctatgaggttatatcctcttacagtaaggtttgc |
33790990 |
T |
 |
| Q |
209 |
tcttgctgctttctctgat |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33790989 |
tcttgctgctttctctgat |
33790971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 149
Target Start/End: Original strand, 33764098 - 33764212
Alignment:
| Q |
35 |
taatccatcacgtcttcctgtaggaacattgtaacttggtccacctgctaagacaactgaatctcttgttgctaatgatattatgtctgcacatgaaact |
134 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||| ||||||| || | |||| | || | ||||||||| || | || || ||||||||||||||||| |
|
|
| T |
33764098 |
taatccgtcacgtcttcctgtaggaatattgtattttggtcctccagataaggccacagcatctcttgtagcaagtgctacgatgtctgcacatgaaacc |
33764197 |
T |
 |
| Q |
135 |
gttgatggacatgca |
149 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33764198 |
gttgatggacatgca |
33764212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University