View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_246 (Length: 246)
Name: NF6866A_low_246
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_246 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 32893261 - 32893484
Alignment:
| Q |
1 |
gttagattacagtattgtgtctcttaacgatattgctttcaaacagataatagtttacttcttgattttgttgtattagccctctgatttgtaaattaat |
100 |
Q |
| |
|
||||| |||| ||||| | ||||||||||||||||||| |||| |||||||| |||||||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
32893261 |
gttagtttactgtattttctctcttaacgatattgcttacaaaaagataatattttacttcttgattttgttgtattgaccctctgatgtgtatattaat |
32893360 |
T |
 |
| Q |
101 |
ctatttcaacgtattgttcttgaacgagctcttttcattgtgggatgtcgtcccc---gacttggtggtttgaactttacaaccaatgacgttggtaaag |
197 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||||||||| |||||| ||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32893361 |
ctatttcaacgcattgttctttaactagctcttttcattgtggaatgtcggtcccaaaggcttggtggtttgaactttacaaccaatgacgttggtaaag |
32893460 |
T |
 |
| Q |
198 |
ttcttgcaataacatgttcatttt |
221 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
32893461 |
ttcttgcaatattatgttcatttt |
32893484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 161 - 234
Target Start/End: Original strand, 39162189 - 39162262
Alignment:
| Q |
161 |
ggtggtttgaactttacaaccaatgacgttggtaaagttcttgcaataacatgttcatttttcacatctctaat |
234 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| || |||||||||||| || || |||| |||| |||| |||| |
|
|
| T |
39162189 |
ggtggtttgaactttacaactaatgatgttggcaatgttcttgcaatatcaagtacattattcaaatctataat |
39162262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University