View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_261 (Length: 243)
Name: NF6866A_low_261
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_261 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 23 - 183
Target Start/End: Complemental strand, 33246228 - 33246068
Alignment:
| Q |
23 |
agatcatgcttcctactccgatgacggcggtgtcgagttcttatttttctgttacttcttcttctgttcatcaacagcgtcaagagtttttcactttcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246228 |
agatcatgcttcctactccgatgacggcggtgtcgagttcttatttttctgttacttcttcttctgttcatcaacagcgtcaagagtttttcactttcaa |
33246129 |
T |
|
| Q |
123 |
tgctgaaaactcgttttctaataactttcagatgaacccttttcagaatcagttaatggtt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33246128 |
tgctgaaaactcgttttctaataactttcagatgaacccttttcagaatcagttaatggtt |
33246068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University