View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6866A_low_280 (Length: 241)
Name: NF6866A_low_280
Description: NF6866A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6866A_low_280 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 22 - 227
Target Start/End: Complemental strand, 43703279 - 43703074
Alignment:
| Q |
22 |
aaaactaaattttgaatcctatacctcttgctcaagggatccgagccccttcaagtcggaccaactcatgttggtgataaaagtaatgtgaataaaacca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
43703279 |
aaaactaaattttgaatcctatacctcttgctcaagggatccgagccccttcaagtcggaccaactcatgttggcgataaaagtaatgtgaataaaacaa |
43703180 |
T |
|
| Q |
122 |
agtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgtaaatttctctgcataagtgtaactgt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43703179 |
agtttaaactttgtagtgaaataaagtatgttttattttgctcaaaaagcaagtctaacatgaaactttggtgtaaatttctctgcataagtgtaactgt |
43703080 |
T |
|
| Q |
222 |
tgatgt |
227 |
Q |
| |
|
|||||| |
|
|
| T |
43703079 |
tgatgt |
43703074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University